3-11- تحليل آماري25
فصل چهارم: نتايج
4-1- مشخصات افراد شرکت کننده در مطالعه 27
4-2- نتايج حاصل از بررسي عوامل خطر کيفي دخيل در اسکيزوفرنيا 27
4-3- نتايج حاصل از بررسي چند شکلي D/A در ژن XRCC4 28
4-3-1- مقايسه فراواني هاي ژنوتيپي و آللي بين دو گروه شاهد و بيمار 28
4-3-2- مقايسه فراواني هاي ژنوتيپي چند شکلي I/D ژن XRCC4 بين
دو گروه شاهد و بيمار، پس از تعديل عوامل خطر اسکيزوفرنيا 29
4-4- نتايج حاصل از بررسي چند شکلي I/D در ژن آنژيوتنسين 31
4-4-1- مقايسه فراواني هاي ژنوتيپي و آللي بين دو گروه شاهد و بيمار 31
عنوان صفحه
4-4-2- مقايسه فراواني هاي ژنوتيپي چند شکلي I/D ژن آنژيوتنسين،
بين دو گروه شاهد و بيمار، پس از تعديل عوامل خطر بيماري اسکيزوفرنيا 32
فصل پنجم: بحث
5-1- بحث و نتيجه گيري کلي35
فهرست منابع و مآخذ
منابع فارسي 40
منابع انگليسي 41
فهرست جدول ها
عنوان صفحه
جدول 3-1 ، مواد مورد نياز براي تهيه مخلوط واکنش PCR 21
جدول 3-2، برنامه تنظيم شده براي واکنش PCR جهت تکثير ژن XRCC4 . 21
جدول 3-3، باندهاي حاصل از PCR در ژنوتيپ هاي XRCC4 22
جدول 3-4، برنامه تنظيم شده براي واکنش PCR جهت تکثير ژن آنژيوتنسين22
جدول 3-5، باندهاي حاصل از PCR، ژنوتيپ هاي آنژيوتنسين 23
جدول 4-1، بررسي عوامل خطر کيفي دخيل در اسکيزوفرنيا24
جدول 4-2، فراواني هاي ژنوتيپي و آللي چند شکلي ژنتيکي I/D ژن XRCC4
در دو گروه شاهدو بيمار 28
جدول 4-3، مقايسه فراواني هاي ژنوتيپي و آللي چند شکلي I/D ژن XRCC4
بين دو گروه شاهد و بيمار 29
جدول 4-4، مقايسه فراواني هاي ژنوتيپي چند شکلي I/D ژن XRCC4 ،
پس از تعديل سيگار به عنوان عامل خطر اسکيزوفرنيا 29
جدول 4-5، مقايسه فراواني هاي ژنوتيپي چند شکلي I/D ژن XRCC4 ،
پس از تعديل اثر سابقه بيماري در اقوام بيمار، به عنوان عامل خطر اسکيزوفرنيا 30
جدول 4-6، مقايسه فراواني هاي ژنوتيپي چند شکلي I/D ژن XRCC4 ،
پس از تعديل ازدواج خويشاونديوالدين بيمار، به عنوان عامل خطر اسکيزوفرنيا 30
جدول 4-7، فراواني هاي ژنوتيپي و آللي چندشکلي ژنتيکي I/D ژن آنژيوتنسين
در دو گروه شاهد و بيمار 31
عنوان صفحه
جدول 4-8، مقايسه فراواني هاي ژنوتيپي و آللي چند شکلي I/D ژن آنژيوتنسين،
بين دو گروه شاهد و بيمار 32
جدول 4-9، مقايسه فراواني هاي ژنوتيپي چندشکلي I/D ژن آنژيوتنسين، پس از
تعديل سيگار به عنوان عامل خطر اسکيزوفرنيا 32
جدول 4-10، مقايسه فراواني هاي ژنوتيپي چندشکلي I/D ژن آنژيوتنسين، پس از
تعديل اثر سابقه بيماري در اقوام بيمار، به عنوان عامل خطر اسکيزوفرنيا 33
جدول 4-11، مقايسه فراواني هاي ژنوتيپي چندشکلي I/D ژن آنژيوتنسين،
پس از تعديل ازدواج خويشاوندي والدين بيمار، به عنوان عامل خطر اسکيزوفرنيا 33
جدول 5-1، مقايسه فراواني هاي آللي و ژنوتيپي ژن ACE در جمعيت هاي ايران،
شمال هند، ترکيه، ايتاليا 39
فهرست شکل ها
عنوان صفحه
شکل 3-1- نتايج حاصل از PCR-RFLP بر روي ژل براي ژن XRCC424
شکل 3-2- نتايج حاصل از PCR-RFLP بر روي ژل براي ژن ACE24
فصل اول
مقدمه
1-1- اسکيزوفرنيا
اسکيزوفرنيا (روان گسيختگي) سندرومي باليني شامل آسيب هاي رواني متغير اما عميقاً ويرانگري است که شناخت، هيجان1، ادراک و ساير جنبه هاي رفتار را درگير مي کند. بروز اين تظاهر در افراد مختلف و در طول زمان متغير است اما تأثير بيماري همواره شديد و معمولا ديرپا2 است. اسکيزوفرنيا معمولاً قبل از 25 سالگي شروع مي شود و تا آخر عمر پايدار مي ماند و هيچ يک از طبقات اجتماعي از ابتلاي به آن مصون نيستند. بلويلر3 اصطلاح اسکيزوفرنيا را وضع کرده است تا مبيّن گسيختگي4هايي باشد که ميان فکر، احساس، و رفتار بيماران مبتلا به اين اختلال وجود دارد (کاپلان، 1378).
يک درصد جمعيت جهان، به اختلال اسکيزوفرني دچار هستند و معمولا گزارش مي شود که به طور مساوي بر جنس زن و مرد تاثير گذار است (هر چند بحث در مورد خطر بيشتر براي مردان وجود دارد (Aleman et al., 2003).
ميزان بروز ساليانه اسکيزوفرني از 5/0 تا 5 در صد در هر 10000 نفر متغير است و اين ميزان در نواحي جغرافيايي مختلف نيز يکسان نيست. مثلاً، ميزان بروز اسکيزوفرني در افرادي که در نواحي شهري جوامع صنعتي به دنيا آمده اند بيشتر است (کاپلان، 1378).
1-1-2- علائم اسکيزوفرنيا
– نشانه هاي مثبت5: رفتارهاي عجيبي هستندکه به رفتارهاي عادي فرد بيمار افزوده مي شوند و شامل هذيان ها6، تفکر و گفتار از هم گسيخته، توهم7 و رفتارهاي عجيب و غريب8مي باشند.
انواع هذيان:
هذيان گزند و آسيب9: فرد مبتلا تصور مي کند ديگران مي خواهند به او آسيب برسانند.
هذيان عظمت (بزرگ منشي)10: به عنوان مثال فرد مبتلاء تصور مي کند ناپلئون است.
هذيان کنترل: فرد مبتلاء تصور مي کند ديگران افکار او را کنترل مي کنند.
هذيان تني (بدني، جسمي)11: فرد تصور مي کند فکر و ذهنش پاره مي شود.
توهم: در بيماران مبتلا به اسکيزوفرني، هر يک از پنج حس ممکن است دچار حالات توهمي گردد. اما شايع ترين توهم ها، توهم هاي شنوايي است. اين صداها اغلب به تهديد، اهانت، اتهام يا فحاشي مي پردازند. ممکن است دو يا چند صدا باشند که با هم به گفتگو مي پردازند و يا يک صدا باشد که در مورد زندگي يا رفتار بيمار اظهار نظر مي کند. توهم هاي بينايي هم شايع است، اما توهمهاي لمسي، بويايي و چشايي معمول نيست.
– نشانه هاي منفي12: شامل کمبودهايي در شخصيت است و عبارتند از واکنش هاي سطحي، از دست دادن اراده، گريختن از اجتماع، عدم بروز عواطف13 و عدم لذت14 از زندگي مي باشد.
– اختلالات شناختي15: شامل اختلال در توجه، حافظه، تمرکز، يادگيري و حل مساله مي باشد. اختلالات شناختي داراي تاثيري منفي بر روي عملکرد هاي روزانه فرد مي باشد (Palmer et al., 1997, Goldberg et al., 1995).
1-1-3-سبب شناسي16 اسکيزوفرني
بيماري اسکيزوفرني يک بيماري چند عاملي17 است و نتيجه بر هم کنش فاکتورهاي ژنتيکي و محيطي است.
1-1-3-1- عوامل ژنتيکي
در برخي و شايد در تمامي انواع اسکيزوفرني عوامل ژنتيک دخالت دارند و بخش اعظم استعداد ابتلا به اسکيزوفرني مربوط به عوامل ژنتيکي است که اثرات افزايشي دارند. احتمال ابتلا به اسکيزوفرني با ميزان قرابت خوني بستگان مبتلا (درجه اول يا درجه دوم) همبستگي دارد. در دوقلوهاي يک تخمکي که زمينه ژنتيکي يکساني دارند ميزان همگامي در مورد اسکيزوفرني حدود 50 درصد است که اين ميزان چهار يا پنج برابر همگامي دو قلوهاي دو تخمکي يا ميزان بروز در ساير بستگان درجه اول (خواهر و برادرها، والدين يا فرزندان) است. افت بارز بروز اسکيزوفرني دربستگان درجه دوم و سوم بيماران نسبت به بستگان درجه اول نيز نقش عوامل ژنتيک را نشان مي دهد. با اين همه داده هاي مربوط به دوقلوهاي يکسان به طور واضح نشان مي دهند افرادي که زمينه ژنتيکي ابتلا به اسکيزوفرني را دارند الزاماً به اين بيماري دچار
نمي شوند و براي بروز اين بيماري در افراد دخالت عوامل ديگر (مانند عوامل محيطي) ضروري است (کاپلان، 1378). داده هاي قدرتمندي وجود دارند که نشان مي دهند سن پدر همبستگي مستقيمي با بروز اسکيزوفرني دارد. مطالعات انجام شده بر روي آن دسته از بيماران اسکيزوفرني که سابقه بيماري در بستگان پدري يا مادري آنها وجود نداشته است نشان داد افرادي که در زمان تولد سن پدرشان 60 سال يا بالاتر بوده استعداد ابتلا به اين اختلال را پيدا مي کنند Malaspina et al., 2001),(Zammit et al., 2003. احتمالاً توليد اسپرم در مردان مسن بيش از مردان جوان در معرض آسيب اپي ژنتيک قرار دارد (Malaspina et al., 2002).
مدل هاي انتقال ژنتيکي اسکيزوفرني معلوم نيست اما به نظر مي رسد چندين ژن در استعداد ابتلا به اسکيزوفرني نقش دارند. مطالعات ژنتيکي پيوستگي و ارتباط شواهد قوي به نفع 9 مکان پيوستگي ارائه کرده اند:1q، 5q، 6p، 6q، 8p، 10p، 13q، 15q،22q
Straub et al., 2001, Levinson et al., 2003),Badner and Gershon.2002).
تحليل بيشتر اين مکان هاي کروموزومي به شناسايي ژن هاي اختصاصي احتمالي منجر شده است و بهترين ژن هاي احتمالي مطرح عبارتند از:
– نورگولين1 (NRG1,8p21-p12)
– ديسبيندين (DNTBP1,6p22.3)
– ژن RGS4(1q21-22)
– رسپتور D3دوپامين (DRD3,11q22-23)
– رسپتور 2a سروتونين (5HT2a,13q14-q21)
– ژن هاي کتکول-o-متيل ترنسفراز (COMT) و پرولين دهيدروژناز (PRODH2) (22q11)
– ژن هايDISC2 , DISC1 (Disrupted-in-Schizophrenia) (1q) (کاپلان، 1378).
1-1-3-2- عوامل بيوشيميايي
1- فرضيه دوپاميني. ساده ترين شکل فرضيه دوپاميني – اسکيزوفرني اين است که اسکيزوفرني نتيجه فعاليت بسيار زياد دوپامينرژيک است.
2- سروتونين. طبق فرضيات موجود، فزوني سروتونين يکي از علل علايم مثبت و منفي اسکيزوفرني است.
3- گابا. انتقال دهنده عصبي گابا يک اسيد آمينه مهاري است و در پاتوفيزيولوژي اسکيزوفرني دخالت دارد.
4- نوروپپتيدها.
5- گلوتامات.
6- استيل کولين ونيکوتين.
7- نوراپي نفرين.
1-1-3-3- عوامل محيطي
1-سن و جنس. شيوع اسکيزوفرني در مردان و زنان مساوي است ولي شروع و سير بيماري در دو جنس تفاوت دارد. اسکيزوفرني در مردها زودتر از زن ها شروع مي شود. شايع ترين سن شروع در مردها 25-10 و در زنان 35-25 سالگي است. شروع اسکيزوفرني قبل از ده سالگي يا بعد از شصت سالگي بي نهايت نادر است. برخي مطالعات نشان داده است که مردان بيشتر از زنان ممکن است دچار علايم منفي شوند و زن ها بيشتر از مردان ممکن است قبل از شروع بيماري کارکرد اجتماعي بهتري داشته باشند. در کل فرجام بيماران مونث بهتر از بيماران مذکر است ( Rasanen et al., 2000,Jablensky et al., 1992 , کاپلان,1378(.
2- مشکلات مربوط به زايمان18(Cannon et al., 2002).
3- فصل تولد19. افرادي که دچار اسکيزوفرني مي شوند، بيشتر در اوايل زمستان و اوايل بهار متولد شده اند. براي توضيح اين مشاهده، فرضيه هاي گوناگوني را ارائه کرده اند. از جمله اين فرضيه که نوعي عوامل خطرساز مختص اين فصل ها نظير ويروس يا تغيير فصلي برنامه غذايي وجود دارد. فرضيه ديگر اين است که افرادي که استعداد ابتلا به اسکيزوفرني را دارند از برتري زيستي بيشتري براي بقا در برابر صدمات مختص اين فصل ها برخوردارند (1378، کاپلان، Torrey et al., 1997, Tochigi et al., 2004).
4- مهاجرت20. شيوع بيشتر اسکيزوفرني در ميان تازه مهاجران ديده شده است و اين يافته به معناي آن است که تغيير ناگهاني فرهنگي به شکل يک عامل فشار در ايجاد اسکيزوفرني دخالت دارد (1378، کاپلان، Hutchinson and Haasen, 2004).
5- سوء مصرف مواد. سوء مصرف مواد در اسکيزوفرني شايع است. سوء مصرف مواد (به جز توتون) با کارکرد ضعيف تر بيمار همراه است. شيوع مصرف الکل در طول عمر بيماران دچار اسکيزوفرني 40 درصد گزارش شده است. سوء مصرف الکل خطر بستري شدن را افزايش داده و در برخي بيماران ممکن است سبب افزايش علايم روانپريشي (سايکوتيک)21 شود. توجه خاصي به ارتباط مصرف حشيش22 و اسکيزوفرني جلب شده است (کاپلان، 1378) مصرف زياد حشيش (بيش از 50 دفعه) خطر بروز اسکيزوفرني را در مقايسه با کساني که مصرف نمي کنند شش برابر افزايش مي دهد (Arseneault et al., 2004).
6- تراکم جمعيت. در شهرهايي که بيش از يک مليون نفر سکنه دارند بين شيوع اسکيزوفرني و تراکم جمعيت منطقه، همبستگي ديده شده است. ميزان بروز اسکيزوفرني در فرزندان والديني که يک يا هر دوي آنها مبتلا به اسکيزوفرني هستند، در جوامع شهري دو برابر جوامع روستايي است. مشاهدات مذکور همه حاکي از آن است که فشارهاي اجتماعي محيط هاي شهري مي تواند بر وقوع اسکيزوفرني در کساني که در معرض خطرند اثر بگذارد (Pedersen and Mortensen, 2001).
1-1-3-4- آسيب شناسي عصبي
پژوهشگران در انتهاي قرن بيستم در کشف مبناي احتمالي آسيب شناسي عصبي اسکيزوفرني به جهش هاي چشم گيري نائل شدند. اين مبنا در درجه اول در دستگاه ليمبيک23 و عقده هاي قاعده اي قرار دارد و شامل نابهنجاري هايي از نظر آسيب شناسي عصبي يا شيمي عصبي در قشر مخ، تالاموس و ساقه مغز است.

در این سایت فقط تکه هایی از این مطلب با شماره بندی انتهای صفحه درج می شود که ممکن است هنگام انتقال از فایل ورد به داخل سایت کلمات به هم بریزد یا شکل ها درج نشود

شما می توانید تکه های دیگری از این مطلب را با جستجو در همین سایت بخوانید

ولی برای دانلود فایل اصلی با فرمت ورد حاوی تمامی قسمت ها با منابع کامل

اینجا کلیک کنید

کاهش حجم مغز که در بيماران اسکيزوفرني به فراواني گزارش شده است، ظاهراً نتيجه کاهش تراکم آکسون ها، دندريت ها و سيناپس ها است که واسطه انجام کارکردهاي ارتباطي و تداعي ها در مغزند.
تراکم سيناپسي در يک سالگي از هر زمان ديگري بيشتر است، سپس تقليل مي يابد و در اوايل نوجواني به حد بزرگسالي مي رسد. مشاهده شده است که بيماران اغلب در نوجواني دچار علائم اسکيزوفرني مي شوند. بر طبق نظريه اي که تا حدودي مبتني بر اين مشاهده است، اسکيزوفرني در نتيجه هرس شدن مفرط سيناپس ها در اين مرحله از رشد پيدا مي شود (کاپلان، 1378).

1-1-4- انواع اسکيزوفرنيا
1-نوع بدگمان (پارانوئيد)24. اشتغال خاطر به يک يا چند هذيان يا داشتن توهم هاي مکرر شنوايي مشخصه اين نوع اسکيزوفرني است. به طور سنتي اين نوع اسکيزوفرني عمدتاً با هذيان هاي گزند يا خود بزرگ بيني مشخص مي شود.
2-نوع نابسامان25. مشخصه هاي اين نوع اسکيزوفرني که سابقاً کودک رواني (هبفرني) خوانده مي شد عبارت است از پسرفت آشکار به رفتارهاي بدوي، مهارگسيخته و سازمان نيافته است. شروع اين نوع از اسکيزوفرنيا معمولاً زود يعني قبل از بيست و پنج سالگي است.
3- نوع کاتاتونيک26. اين نوع اسکيزوفرن چندين دهه پيش شايع بود و امروزه در اروپا و آمريکا شمالي نادر است. خصيصه اصلي اين نوع اسکيزوفرني شامل آشفتگي واضح در کارکرد حرکتي است که ممکن است شامل بهت، منفي کاري، سفتي عضلات، بر آشفتگي يا اتخاذ وضعيت هاي خاص بدني است.
4-نوع نامتمايز27. غالباً بيماراني را که به وضوح مبتلا به اسکيزوفرني اند نمي شود به راحتي در يکي از انواع ذکر شده گنجاند. اين بيماران را تحت عنوان مبتلايان به اسکيزوفرني از نوع نامتمايز دسته بندي مي کنند.
5- نوع باقي مانده28. وجود مداوم شواهد اختلالي از نوع اسکيزوفرني، در غياب مجموعه کامل علايم مرحله فعال يا علايمي که براي تشخيص نوع ديگري از اسکيزوفرني کافي باشد، مشخصه نوع باقي مانده است (کاپلان، 1378).
1-1-5- درمان اسکيزوفرنيا
اگرچه داروهاي ضد روانپريشي29 تکيه گاه اصلي درمان اسکيزوفرني به شمار مي روند، در پژوهش ها معلوم شده که مداخله هاي رواني- اجتماعي، از جمله روان درماني مي توانند بهبود باليني را تقويت کنند. پيچيدگي اسکيزوفرني سبب مي شود هيچ رويکرد درماني به تنهايي براي مقابله با اين اختلال چند وجهي کفايت نکند. براي اکثر بيماران مبتلاء به اسکيزوفرني، کاربرد ترکيبي از ضد روان پريشي ها و درمان هاي رواني- اجتماعي، سودمندتر از کاربرد هريک از اين درمان ها به تنهايي خواهد بود (Bustillo et al., 2001).
داروهايي که در درمان اسکيزوفرني به کار مي روند خواص دارويي بسيار متنوعي دارند، اما وجه مشترک همه آنها آنتاگونيسم30 بودن براي گيرنده هاي دوپاميني پس سيناپسي در مغز است. اين داروها را مي توان به دو گروه عمده تقسيم کرد: 1- داروهاي ضد روان پريشي متعارف قديمي که داروهاي ضد روان پريشي نسل اول يا آنتاگونيسم هاي گيرنده دوپامين نيز ناميده مي شوند و 2- داروهاي جديدتر که داروهاي ضد روان پريشي نسل دوم يا آنتاگونيسم هاي سروتونين – دوپامين ناميده مي شوند (کاپلان، 1378).
متاسفانه داروهاي ضدرواني داراي عوارض جانبي ناخوشايند از جمله افزايش وزن، خشکي دهان و يبوست مي باشند. بر طبق مطالعات انجام شده مصرف طولاني مدت اين داروها همراه با افزايش توليد راديکال هاي آزاد مي باشد (1376، هاريسون ،McGorry and Yung, 2003).
1-2- ژن ترميمي XRCC4
آسيب به مولکولDNA به طرق مختلف مي تواند به وجود آيد. آسيب به DNA مي تواند به صورت شکست هاي خود به خودي در پيوندهاي شيميايي اين مولکول يا به وسيله عوامل محيطي از قبيل پرتوهاي فرابنفش و پرتوهاي يوني و يا به وسيله واکنش با ترکيبات شيميايي ژئوتوکسيک که به طور طبيعي در متابوليسم سلولي توليد شده و يا در محيط وجود دارند به وجود آيد.
جلوگيري از وقوع اشتباه در تواليDNA در سلول هاي مختلف براي حيات ضروري مي باشد. در نتيجه سلول براي تعمير DNA آسيب ديده و تصحيح اشتباه در توالي، چندين مکانيسم ترميمي را در خود به وجود آورده است. در واقع مکانيسم هاي ترميمي DNA باعث حفظ آن در برابر آسيب هاي درون زاد31 و برون زاد32 مي شوند Kiyohara et al., 2006), Lindahl,1995,(Wood et al., 2005.
به طور قابل توجهي نقص در مکانيسم هاي ترميم DNA با به وجود آمدن سرطان رابطه خيلي نزديکي دارند. وقتي که مکانيسم هاي ترميمي، جهش را از بين نبرد اين جهش ها در سلول جمع مي شوند. اگر اين جهش ها ژن هايي که در تنظيم تقسيم سلولي شرکت مي کنند را تحت تاثير قرار دهند منجر به توليد تومور و در پي آن سرطان مي شوند (1378، رابينز، Lewin, 1999).
اشعه هاي يونيزان (مثل تابش ايکس و گاما) و برخي داروهاي ضد سرطان باعث ايجاد شکست هاي دو رشته اي در مولکول DNA مي شوند. اين شکست ها باعث آسيب هاي جدي در مولکول DNA مي شوند زيرا اتصال مجدد قطعه جدا شده به بقيه DNA اگر اشتباه صورت بگيرد مي تواند منجر به از بين رفتن ترتيب صحيح کروموزومي و عمل کرد ژن ها شود. به عنوان مثال، اتصال اشتباه مي تواند باعث ايجاد يک ژن هيبريد شود و يا پروموتر يک ژن نزديک ناحيه کد کننده ژن ديگر قرار گيرد و در نتيجه سطح بيان آن ژن را تغيير دهد.
دو مکانيسم براي ترميم شکست هاي دو رشته اي وجود دارد. در واقع مکانيسم غالب براي ترميم چنين شکست هايي در جانداران پر سلولي اتصال انتهاي غير همولوگ (NHEJ)33 مي باشد. مکانيسم دوم براي ترميم چنين شکست هايي، نوترکيبي همولوگ مي باشد34.
انواعي از ژن هاي ترميمي در ژنوم انسان وجود دارند از جمله ژن 35XRCC4 که داراي نقش مهمي در مسير ترميمي NHEJ است (Chiu et al., 2008b). ژن XRCC4 روي کروموزوم 5q14.2 قرار دارد. پروتئين کد شونده توسط اين ژن داراي 336 اسيد آمينه است که در واقع درون 8 اگزون قرار دارد (Wang et al., 2010).
XRCC4 داراي يک دمين هليکالي بلند است که مسئول برهم کنش با DNA ليگاز4
مي باشد به علاوه اين پروتئين به عنوان يک کمند انعطاف پذير بين KU70وKU80 عمل
مي کند. XRCC4به وسيله تشکيل کمپلکس با DNA ليگاز4 و پروتئين کيناز وابسته به DNA در ترميم شکست هاي دورشته اي DNA به وسيله مسير ترميميNHEJ دخاالت
مي کند .(Chang et al., 2009)
با توجه به مطالعاتي که بر روي مدل هاي حيواني انجام شد، موش هايي که در آن ها ژن XRCC4 غير فعال بود فاقد عمل کردي نرمال در تمايز لنفوسيت ها و نرون ها بودند که در نتيجه منجر به کشندگي جنيني مي شد (Chang et al., 2008). چند شکلي نوکلئوتيدي36 (SNP) حاصل يک جايگزيني بازي است. SNPدر ناحيه کدکننده پروتئين باعث دو نوع موتاسيون از نوع missense (synonymous) و nonsense (nonsynonymous) مي شود به علاوه SNP در منطقه پروموتر باعث افزايش يا کاهش بيان ژن مي شود در حالي که SNP در منطقه اينترون ژن باعث نقص در پردازش يا تغيير در سرعت رونويسي مي شود .(Hsieh et al., 2008) انواعي ازSNP در ژن XRCC4 شناسايي شده است يکي از آن ها حذف و اضافه موجود در اينترون 3 اين ژن مي باشد.
3-1- ژن آنژيوتنسين
سيستم رنين- آنژيوتنسين داراي دو نقش مهم در تنظيم فشار خون و کارکرد کليه ها مي باشد
.(Akman et al., 2009) جايگاه اصلي اين سيستم در ديواره رگ ها مي باشد و داراي دو نقش مهم در کنترل انقباض رگ ها و هم چنين کنترل فرآيند التهاب از طريق کاهش توليد سيتوکين ها37 مي باشد.(Karakus et al., 2013) ACE يک آنزيم کليدي در سيستم
رنين- آنژيوتنسين مي باشد. اين آنزيم يک دي پپتيديل کربوکسي پپتيداز است که با برداشتن يک دي پپتيد از C ترمينال، آنژيوتنسين I غيرفعال آن را به آنژيوتنسينII فعال به فرم اکتاپپتيد تبديل مي کند. علاوه بر اين ACE برادي کينين هاي ملتهب کننده عروق را از طريق سيستم kallikrein-kininogen کاهش مي دهد. به علاوه مطالعات حيواني نشان داد که ACE تبديل دوپامين در مغز مياني را تنظيم مي کند (Raza et al., 2013).
ACE يک آنزيم خارج سلولي است که برروي غشاء پلاسمايي38 انواع مختلفي از سلول ها از جمله سلول هاي آندوتليال ديواره رگ ها، سلول هاي لوله هاي پروکسيمال رنال و هم چنين در سلول هاي اپيتليال موجود درمغز و مايع هاي بيولوژيکي از جمله پلاسما و مايع
مغزي-نخاعي موجود مي باشد .ژن کد کننده ACE روي بازوي بزرگ کروموزوم 17 (17q 23) قرار دارد. اين ژن 21 کيلو باز طول دارد و شامل 26 اگزون و 25 اينترون مي باشد (Subbiah et al., 2011).
چندين مطالعه نشان داد که پلي مورفيسم هاي ژن ACE بر روي قابليت ابتلاءپذيري فرد به تعدادي از بيماري ها از جمله فشار خون39، بيماري هاي قلبي40 و ديابت تيپ دو اثر دارند.(Yang et al., 2013) ژن ACE داراي انواعي از پلي مورفيسم ها مي باشد از جمله پلي مورفيسم حذف و اضافه توالي تکراري 287 ALU که در انتهاي´3 اينترون 16 واقع مي باشد. در واقع اين پلي مورفيسم به طور قوي با ميزانACE موجود در سلول و پلاسما مرتبط است و نشان داده شده که اين پلي مورفيسم ممکن است بيان ژن ACE را تنظيم کند
(Markus et al., 1995).
4-1-هدف
با توجه به اين که XRCC4 يکي از ژن هاي مهم در مسير ترميم DNAدو رشته اي آسيب ديده است تا به حال مطالعات زيادي ارتباط بين چند شکلي هاي اين ژن و بيماري هاي مختلف از جمله سرطان را برسي کرده اند. هم چنين با توجه به نقش ژن آنژيوتنسين در تنظيم تبديل دوپامين در مغز مياني مطالعات زيادي به بررسي ارتباط اين ژن با بيماري اسکيزوفرنيا پرداخته اند. هم چنين با توجه به گزارشات رسيده در زمينه تاثير منفي بيماري هاي رواني بر کيفيت زندگي افراد مبتلا، قصد داريم مطالعه اي با هدف برسي ارتباط بين چند شکلي I/Dواقع در اينترون 3 ژنXRCC4 و اينترون 16 ژن آنژيوتنسين و خطر ابتلاء به اسکيزوفرنيا انجام دهيم.
فصل دوم
مروري بر تحقيقات گذشته
1-2- مطالعات زيست شناختي اسکيزوفرنيا
اسکيزوفرني يک بيماري چند عاملي محسوب مي شودکه هر دو عامل ژنتيک و محيط در بروز آن نقش دارند. چندين مطالعه ژنوم اسکن41 ارتباط بين نواحي مختلف کروموزومي و بيماري اسکيزوفرني را نشان مي دهند. مطالعات linkage disequilibrium بر روي اين نواحي چندين ژن را با اين بيماري مرتبط مي دانند (Zakharyan et al., 2011). مطالعات زيادي ارتباط بين نواحي مختلف کروموزومي و بيماري اسکيزوفرني را مورد برسي قرار داده اند.
2-2- مطالعات انجام شده در رابطه با XRCC4
مولکول DNA، مخزن اطلاعات وراثتي و دستورالعملي براي عملکرد صحيح ارگانيسم مي باشد و در واقع آسيب به اين مولکول تهديد جدي براي پايداري ژنتيکي است. در ژنوم انسان تعدادي از ژن ها از جمله XRCC4درگير در مسيرهاي ترميم DNA مي باشند. در واقع افرادي که با ناهنجاري هاي وراثتي در ژن هاي ترميم کننده DNA متولد مي شوند در معرض خطر بيشتري براي ابتلا به انواع سرطان ها قرار دارند Kiyohara et al., 2006), Lindahl,1995,(Wood et al., 2005. چندين مطالعه به برسي ارتباط بين پلي مورفيسم حذف و اضافه موجود در اينترون 3 ژن XRCC4 و انواعي از سرطان ها پرداخته اند. بر اساس پژوهشي که در سال 2008 در تايوان انجام شد بين پلي مورفيسم (G 1394 T) ژن XRCC4 و سرطان سينه ارتباط معناداري وجود دارد و در واقع احتمال ابتلا به اين سرطان در افراد با ژنوتيپ T/Tو 2.33 G/T برابر بيشتر از افراد با ژنوتيپG/G است. (Chiu et al., 2008b). چندين مطالعه به طور جداگانه در سالهاي 2008 و 2009 در تايوان به بررسي ارتباط بين پلي مورفيسم حذف و اضافه در اينترون سه ژن XRCC4 و سرطان هاي پروستات، معده و مثانه پرداخته اند و ارتباط معنادار مشاهده نشد Chang et al., 2008), Hsieh et al., 2008, (Chang et al., 2009.
در سال 2007 در تايوان پژوهشي به منظور بررسي ارتباط بين پلي مورفيسم حذف و اضافه در اينترون سه ژن XRCC4 و سرطان دهان انجام شد و بر اساس اين پژوهش احتمال ابتلا به اين سرطان در افراد با ژنوتيپ I/D57/1 برابر بيشتر از افراد با ژنوتيپ I/I است
(Tseng et al., 2008). مطالعه ديگري در تايوان به برسي ارتباط بين پلي مورفيسم حذف و اضافه در اينترون 3 ژن XRCC4 و احتمال ابتلا اطفال به لوکميا پرداخت و بر اساس اين پژوهش آلل D عامل خطري براي اين بيماري محسوب مي شود (Wu et al., 2010). بر اساس مطالعه اي که در شمال هند به برسي ارتباط بين پلي مورفيسم حذف و اضافه ژنXRCC4 و سرطان پروستات پرداخت ژنوتيپ D/D احتمال ابتلا به اين سرطان را افزايش مي دهد (Mandal et al., 2011).
2-3 مطالعات انجام شده در مورد ژن آنژيوتنسين
مطالعات زيادي به برسي ارتباط بين پلي مورفيسم حذف و اضافه موجود در اينترون 16 ژن آنژيوتنسين و انواعي از بيماري هاي رواني از جمله اسکيزوفرنيا پرداخته اند. براساس مطالعاتي که جداگانه در دو کشور ترکيه و هند انجام شد ارتباط معناداري بين پلي مورفيسم حذف و اضافه ژن آنژيوتنسين و بيماري اسکيزوفرنيا وجود دارد. نتايج حاصل از اين مطالعات شيوع پاييني از آلل I را در بيماران اسکيزوفرنيا نشان داد و بر اين اساس آلل I مي تواند عاملي محافظت کننده بر عليه اسکيزوفرنيا باشد. هم چنين بر اساس اين مطالعات يک وابستگي مثبت بين ژنوتيپ D/D و ميزان ACE موجود در سرم وجود دارد و سطح اين آنزيم به طور معناداري در افراد اسکيزوفرن با ژنوتيپ D/D در مقايسه با ژنوتيپ I/D وI/I بيشتر است Kucukali et al., 2010)).
بر خلاف دو مطالعه بالا بر اساس مطالعه اي که در کشور اسپانيا انجام شد آلل D به عنوان يک عامل محافظت کننده در برابر اسکيزوفرنيا مي باشد و بر اساس همين مطالعه آلل D خطر ابتلا به اسکيزوفرنيا را تا 50 درصد کاهش مي دهد (Crescenti et al., 2009). بر اساس مطالعاتي که در کشورهاي ترکيه، فلسطين اشغالي و تايوان انجام شد هيچ ارتباط معناداري بين پلي مورفيسم حذف و اضافه ژن آنژيوتنسين و بيماري اسکيزوفرنيا وجود ندارد
Baskan et al., 2010), Segman et al., 2002, .(Ouyang et al., 2001
بر اساس مطالعه انجام شده در کشور کره جنوبي ارتباط معناداري بين ژن آنژيوتنسين و بيماري اسکيزوفرني وجود ندارد اما بر اساس همين مطالعه بين تعداد آلل D در افراد اسکيزوفرني و افزايش شدت نشانه هاي اسکيزوفرني ارتباط معناداري وجود دارد.
(Nadalin et al., 2012).
بر اساس مطالعه اي در ژاپن ارتباط معناداري بين پلي مورفيسم حذف و اضافه، ژن آنژيوتنسين و Polydipsia/Water intoxication در بيماران اسکيزوفرنيا وجود دارد. نتايج حاصل از اين مطالعه نشان داد که آلل D ممکن است يک فاکتور خطر براي Polydipsia/Water intoxication در بيماران اسکيزوفرني باشد(Shinkai et al., 2003).
2-4- فرضيات
در اين پژوهش ها فرض بر اين است که:
1- ژنوتيپ D/D متعلق به چند شکلي Insertion/Deletionاينترون 3 ژن XRCC4، در مقايسه با ژنوتيپ I/I اين ژن احتمال ابتلا به اسکيزوفرن را افزايش مي دهد.
2- ژنوتيپ D/D در مقايسه با ژنوتيپ I/I در چند شکلي Insertion/Deletion اينترون 16 ژن آنژيوتنسين، خطر ابتلا به اسکيزوفرن را افزايش مي دهد.
فصل سوم

وسايل، مواد و روش ها
3-1- نمونه گيري
363 فرد مبتلا به اسکيزوفرنيا با ميانگين سني 13± 5/41، به صورت تصادفي از بيمارستان
ابن سينا و بيمارستان اعصاب و روان رازي در شهر شيراز انتخاب شدند. از ميان مراجعه کنندگان به مرکز انتقال خون (بدون سابقه رواني) 363 نفر با ميانگين سني 1/11±7/39 به عنوان گروه کنترل انتخاب شدند. از هر فرد شرکت کننده در اين مطالعه 5/1 ميلي ليتر خون گرفته شد و در لوله هاي حاوي EDTA و شرايط دمايي 4 درجه سانتي گراد به آزمايشگاه آورده شد.
اطلاعات مورد نياز از افراد شرکت کننده در اين مطالعه از طريق پرسشنامه اي که توسط هر فرد تکميل گرديد به دست آمد.
3-2- وسايل مورد نياز
* سمپلر (Socorex و Brand)
* تانک الکتروفورز (پايا پژوهش)
* ترازو
* ميکروسانتريفيوژ (Hettich)
* Vortex (Scientific industries INC)
* مايکروويو (بوتان)
* ترموسايکلر (Techne)
* Rotator (پديده نوژن پارس)
* PH meter (Metrohm)
* Hot plate (Techne)
* دستگاه Gel documentation (Uvitec Cambridge)
* Heater
* Incubator
* اتوکلاو (ريحان طب)
3-3- مواد مورد نياز
* محلول NH4Cl (170 ميلي مولار)
* NaCl-EDTA (10 ميلي مولار)
* NaOH (50 ميلي مولار)
* Tris HCl (1مولار)
* پرايمرهاي رفت و برگشت ژن XRCC4 و آنژيوتنسين (سيناژن)
* بافر X10 مخصوص PCR (سيناژن)
* MgCl2 (سيناژن)
* dNTPs (سيناژن)
* Taq DNA polymerase(سيناژن)
* بافر TBE (X 5/.)
* محلول اتيديوم برومايد (X 1000)
* loading Buffer 6X(سيناژن)
* Agarose (Invitrogen)
* DNA Ladderbp100 (Vivantis)
* Buffer G (Fermentas)
* Boric acid (Merck)
* EDTA (Merck)
* Tris Base (سيناژن)
3-4- تهيه محلول ها
محلول هاي مورد نياز در اين مطالعه با روش هاي معين تهيه شده اند (راضيه اجتهادي,1392).
3-5- استخراج DNA از خون محيطي به روش جوشاندن ((Boiling
استخراج DNA به روش جوشاندن (Boiling) در آزمايشگاه انجام شد (راضيه اجتهادي ,1392).
3-6- واکنش زنجيره‌اي پليمراز (PCR)42
کليه مواد لازم جهت تهيه مخلوط PCR به جز آنزيم Taq بايد ذوب و ورتکس گردند. مخلوط PCR را طبق جدول 3-1 تهيه مي کنيم. به هر تيوپ مخلوط PCR و DNA template اضافه مي گردد و سپس تيوپ ها را در دستگاه PCR با برنامه ارائه شده در جدول 3-2 قرار
مي دهيم.
جدول 3-1- مواد مورد نياز براي تهيه مخلوط واکنش PCR
اجزاي واکنشحجم مورد نياز به ازاي هر واکنش (ميکروليتر)غلظت نهايي (ميکروليتر)X buffer105/2X1(mM10)dNTP5/0mM2/0(mM 50) MgCl275/0mM 5/1پرايمر رفت 1pmol 4/0پرايمر برگشت 1pmol 4/0Taq DNA polymerase
(u/ml 5)3/0u/µl06/0آب استريل95/13DNA استخراج شده5
3-7- تعيين ژنوتيپ ژن XRCC4
جهت تعيين ژنوتيپ موجود در اينترون شماره 3 ژن XRCC4 از پرايمرهاي زير استفاده شد (Chiu et al., 2008a).
Forward: 5?-TCCTGTTACCATTTCAGTGTTAT -3?
Reverse: 5?-CACCTGTGTTCAATTCCAGCTT -3?
جدول 3-2- برنامه تنظيم شده براي واکنش PCR جهت تکثير ژن XRCC4
مرحلهدمازماندناتوراسيون اوليه43C?945 دقيقهدناتوراسيون44C?9430 ثانيه35سيکلاتصال45C?5530 ثانيهطويل شدن46C?7230ثانيهبسط نهايي47C?7210 دقيقهبعد از PCR بلافاصله الکتروفورز مي نمائيم. باند‌هاي حاصل از چند ‌شکلي داراي الگويي مطابق با جدول 3-3 مي باشد.
جدول 3-3- باندهاي حاصل از PCR در ژنوتيپ هاي XRCC4
ژنوتيپباندها (جفت باز)II139ID109،139DD109
3-8- تعيين ژنوتيپ ژنآنژيوتنسين
جهت تعيين ژنوتيپ موجود در اينترون شماره 16 ژن آنژيوتنسين توالي پرايمري زير استفاده شد .(Subbiah et al., 2011)
Forward: 5’CTGGAGACCACTCCCATCCTTTCT3
Reverse: 5’GATGTGGCCATCACATTCGTCAGAT3
برنامه PCR، جهت تکثير الگوي مورد نظر براي اين ژن در جدول 3-4 آمده است:
جدول 3-4- برنامه تنظيم شده براي واکنش PCR جهت تکثير ژن آنژيوتنسين
مرحلهدمازماندناتوراسيون اوليهC?945 دقيقهدناتوراسيونC?9430 ثانيه30 سيکلاتصالC?6430 ثانيهطويل شدنC?7230 ثانيهبسط نهاييC?725 دقيقه
بعد از PCR بلافاصله الکتروفورز مي نمائيم. باند‌هاي حاصل از چند‌شکلي داراي الگويي مطابق با جدول 3-5 تعيين گرديد.
جدول 3-5- باندهاي حاصل از PCR، ژنوتيپ هاي آنژيوتنسين
ژنوتيپباندها (جفت باز)II490ID190،490DD190
3-9- الکتروفورز
جهت تعيين الگوي چند‌شکلي هاي مورد مطالعه در ژن هاي XRCC4 و آنژيوتنسين، الکتروفورز بر روي ژل آگارز 5/1 درصد با استفاده از بافرTBE انجام گرفت. بدين منظور، بسته به حجم سيني ژل مورد استفاده، مقدار مورد نياز آگارز جهت تهيه ژل 5/1 درصد محاسبه و در حجم مناسب از بافر حل مي شود. ظرف حاوي بافر و پودر آگارز تا زماني که پودر به طور کامل در بافر TBEحل گردد و محلول شفافي بدست آيد، در دستگاه مايکروويو قرار مي گيرد. زماني که دماي محلول به حدود 50 تا 60 درجه سانتي گراد رسيد در سيني ژل ريخته و شانه‌ي ژل درون آگارز مذاب قرار داده مي شود.
پس از حدود 20 تا 30 دقيقه و سرد شدن کامل ژل شانه به آرامي از ژل خارج شده و سيني ژل در درون تانک الکتروفورز حاوي بافر TBE قرار مي دهيم به طوري که محلول کاملاً روي چاهک‌هاي ژل را بپوشاند. سپس محصولات حاصل از PCR ژن هاي XRCC4 و آنژيوتنسين، توسط سمپلر، پس از مخلوط شدن با مقدار مناسب از بافر6x Loading dye درون چاهک‌ها ريخته و به منظور ارزيابي اندازه قطعات، در يکي از چاهک‌ها100bp DNA Ladder ريخته و سپس دستگاه الکتروفورز به منبع تغذيه‌ي جريان الکتريکي متصل و بر روي ولتاژ و آمپر مناسب تنظيم مي شد.
3-10- رنگ‌ آميزي ژل
پس از پايان الکتروفورز جهت قابل رويت شدن قطعات DNA توسط نور UV، ژل آگارز در محلول TBE حاوي اتيديوم برومايد (mg/ml1) قرار گرفت و پس از حدود 10 دقيقه رنگ آميزي، ژل به دستگاهGel Documentation منتقل گرديده و از آن عکسبرداري صورت گرفت.
شکل 3-1- نتايج حاصل از PCR بر روي ژل براي ژن XRCC4
شکل 3-2- نتايج حاصل از PCR بر روي ژل براي ژن ACE
3-11- تحليل آماري
نتايج حاصل از اين مطالعه با استفاده از نرم افزار آماري SPSS و به کار‌گيري روش هاي مربع کاي (?2) و رگرسيون لجستيک، با در نظر گرفتن سطح معني داري 05/0>P، مورد تجزيه و تحليل قرار گرفت.
فصل چهارم
نتايج


دیدگاهتان را بنویسید